5770 Journal of Horticultural Sciences Journal of Horticultural Sciences 0973-354X Society for Promotion of Horticulture India subbaraman.Sriram@icar.gov.in 577074698007 Original Research Papers Validation of Molecular Markers Genetically Linked to S-Cytoplasm and Restoration-of-fertility (Rf) Loci in Hot Pepper (Capsicum annuum L.) Jessy Mol K.K. Lakshmana Reddy D.C. kmreddy14@gmail.com Manoj Y.B. Madhavi Reddy K ICAR- Indian Institute of Horticultural Research, Bengaluru-560 089 ICAR- Indian Institute of Horticultural Research India ICAR- Indian Institute of Horticultural Research, Bengaluru-560 089, India ICAR- Indian Institute of Horticultural Research India ICAR- Indian Institute of Horticultural Research, Bengaluru-560 089, India ICAR- Indian Institute of Horticultural Research India ICAR- Indian Institute of Horticultural Research, Bengaluru-560 089, India ICAR- Indian Institute of Horticultural Research India Junio 2020 15 1 52 61 05 08 2019 27 05 2020 https://creativecommons.org/licenses/by-nc-sa/4.0/ Esta obra está bajo una Licencia Creative Commons Atribución-NoComercial-CompartirIgual 4.0 Internacional. Abstract

Existence of CGMS system in hot pepper is due to the rearrangements in the mitochondrial genome and is largely used in economized and pure F. hybrid seed production around the world. The orf456, a new ORF present at flanking region of the coxII gene at the 3’ end, was distinguished male sterile cytoplasm in hot peppers along with atp6-2gene. In the current study, eighteen pepper genotypes (nine each of A and corresponding B lines) of varied origin were used to validate with two male sterile cytoplasm (S-cytoplasm) specific sequence characterised amplified region (SCAR) markers viz., atp6-2(875 bp) and orf456(456 bp) and one restoration-of-fertility (Rf) locus specific marker, CRF (550 bp) . The results clearly showed that the presence of CMS-S-cytoplasm and absence of restoration-of-fertility (Rf) gene in the pepper genotypes studied and is comparable with the phenotypic data. In view of the outcomes it has been reasoned that the accessible S and Rf markers available in the public domain are reproducible and can be promptly utilized for marker assisted selection (MAS) in hot pepper crop improvement program.

Keywords CGMS Hot pepper Marker Assisted Selection Mitochondria ORF <bold>INTRODUCTION</bold>

Peppers are commercially grown as a spice and vegetable crop. Hot pepper is a Solanaceous crop, originated in Central and South America, and is introduced to India over 500 years ago.Among the domesticated species, Capsicum annuum L is one of the most extensively cultivated pepper species in India. In India, 75% of chilli production is from the southern states viz., Andhra Pradesh, Telangana, Karnataka, Tamil Nadu and Maharashtra. Concerted efforts in thecrop improvement program in pepper resulted in release of many improved varieties and F1 hybrids for commercial cultivation. Utilization of male sterile systems in F1 hybrid seed production of peppers is exceptionally economical.

Male sterility in crops is due to a failure to produce functional pollen or anthers (Grelonet al., 1994, Pruitt and Hanson, 1991; Budar and Pelletier, 1994). CMS/ CGMS is exploited for the development of F1 hybrids in many crops around the world (Hanson, 1991; Hanson and Bentolia, 2004; Miller and Bruns, 2016). Generally,CMS resulted due to the rearrangements in the mitochondrial genome sequences,which in turn results in the arrangement ofnew open reading frames (ORF) which alter the expression of normal genes of the mitochondrial ATP synthesis complex (Pruitt and Hanson,1991; Budar and Pelletier, 1994). The rearrangements within the sub unit genes of ATP synthesis, such as atp 4, 6, 8 and 9 (Pruitt and Hanson, 1991; Hanson and Bentolia, 2004; Schanable and Wise, 1998 Pruitt and Hanson, 1989) are responsible for the CMS in crops and other gene rearrangements observed in pepper lines will be contributed by coxII and nad9.

Hot pepper genotype PI164835, a collection from India was the first CMS line reported (Peterson, 1958), and is being used in production of F. hybrid seeds all over the world (Reddy et al., 2002). In this CMS line, a new ORF viz., orf456 was found as flanking region of the coxII gene at the 3’ end. The atp6-2 gene is believed to be regulated through restoration-of-fertility (Rf) loci at the transcriptional level and the orf456is regulated at post transcriptional or translational level (Kim et al., 2006; Kim et al., 2007), are responsiblef or CMS trait. In the present study, the four stable CGMS lines developed and being use dinpepper improvement program at ICAR-IIHR, Bangalore are validated with the two male sterile cytoplasm (S-cytoplasm) trait linked markers, atp6-2 and orf456 and one restoration-of-fertility(Rf) loci linked to CRFmarker.

<bold>Molecular markers used for the validation of male sterile lines in the present study</bold> Table 1 Molecular markers used for the validation of male sterile lines in the present study
Marker name (Nature) Primer Sequence (52 to 32 ) Annealing temperature (OC) Expected amplicon size of primer (bp) Reference
atp6-2 (SCAR) F AGTCCACTTGAACAATTTGAAATAATC R - GTTCCGTACTTTACTTACGAGC 58 875 bp Ji et al. (2013)
orf456 (SCAR) F - ATGCCCAAAAGTCCCATGTA R - TTACTCGGTTGCTCCATTGTTT 60 456 bp Kim et al. (2007)
CRF (SCAR) F - GTACACACCACTCG-TCGCTCCT R - TTCTTGGGTCCCTTT-CTTCCAA 55 870 bp Gulyas et al. (2006)

<bold>MATERIALS AND METHOD</bold> <bold>Plant material</bold>

An aggregate of nine male sterile and their comparing nine maintainer lines were utilized in the current study are referenced in the Table 2.

 <bold>Phenotypic evaluation of male sterility</bold>

The phenotypic evaluation of male sterility and fertility in lines were carried out by the visual observation at the flowering stage.The male sterile plants showed no pollen grains with shriveled anther lobes, whereas the male fertile plants have bulged anther lobes with abundant pollen grains (Plate 1).

 <bold>Pollen morphologyandsize</bold>

The freshly unopened flower samples of male sterile and male fertile plants were gathered from the field in the early dawn,and put away in impenetrable zip lock polythene covers over the ice package to keep up the freshness. The pollen grains were collected from the dehisced anther lobes independently from individual flowers, frozen on the liquid nitrogen and stored them at -1950 for further studies. For morphological examinations, the individual pollen grains were directly dusted on to the slides and length and breadth of the individual grains were measured using scanning electronmicroscope (TM3000, Hitachi, Japan). The reproductive parts of both male sterile and male fertile flowers and the cross section of the anther lobes were additionally seen under the scanning electronmicroscope (TM3000, Hitachi, Japan),in order to study the morphological difference between the male sterile and male fertile flowers.The stereo microscopy images of the dehisced flowers were additionally examined .ZEISS Stereo zoom microscope Stemi 508 doc, Germany).

 <bold>DNA extraction:</bold>

The total genomic DNA was isolated from the leaves of one month old seedling using 4% CTAB plant extraction protocol (Doyle and Doyle, 1990). The genomic DNA samples were qualitatively checked in 0.8% agarose gel and quantitatively by using UV- spectrophotometer. The concentrated DNA was diluted to 20ng/µL according to the spectrophotometer reading and thus diluted DNA is used as the template in PCR for genotyping with specific molecular markers.

 <bold>PCR conditions and validation of molecular markers:</bold>

The polymerase chain reaction master mixture contained 2µL of 10X buffer, 2µL 25 mM MgCl., 2.5µL 1mM dNTP, (3b Blackbio, Spain ) 1.5µL of 10µM of forward and reverse primer, 0.5µL 1U Taq DNAPolymerase (3b Blackbio, Spain) and 2µL of 20ng template DNA. The PCR conditions for the validation of the three SCAR markers were carried out as mentioned here. Initial denaturation at 950 for 5 minutes accompanied with 30 repeated cycles of denaturation at 940 for 60 seconds, annealing as given in the Table 1 for 60 seconds, extension at 720 for 60 seconds and final extension at 720 for 5 minutes. The reactions were carried out in the thermocycler (Eppendorf, Germany). PCR amplified fragments were separated on 1.5% agarose gel/1X TBE (w/ vol), stained with ethidium bromide dye and documented under neath the ultra violet light (UVIPro Platinum, Cambridge, U.K). The experimentswere repeated for three consecutive times with eachmarker for confirmation of results.

<bold>Results of the markers screened for CGMS lines</bold> Table 2 Results of the markers screened for CGMS lines
Sl.No. Sample Name PCR Amplification of SCAR markers Observed Phenotype Expected Genotype
atp6-2 orf 456 CRF
Male sterile lines
1 IIHR 3285 A + + - Sterile S
2 IIHR 3226 A + + - Sterile S
3 IIHR 3287 A + + - Sterile S
4 IIHR 3228 A + + - Sterile S
5 IIHR 4560 A + + - Sterile S
6 IIHR 4561 A + + - Sterile S
7 IIHR 4558 A + + - Sterile S
8 IIHR 4553 A + + - Sterile S
9 IIHR 4555 A + + - Sterile S
Male fertile lines
10 IIHR 3285 B - - - Fertile N
11 IIHR 3226 B - - - Fertile N
12 IIHR 3287 B - - - Fertile N
13 IIHR 3228 B - - - Fertile N
14 IIHR 4560 B - - - Fertile N
15 IIHR 4561 B - - - Fertile N
16 IIHR 4552 B - - - Fertile N
17 IIHR 4554 B - - - Fertile N
18 IIHR 4556 B - - - Fertile N
19 Control R- line - - + Fertile N

ar diagram showing the measurement of individual pollen grains size in male sterile vs male fertile flowers using scanning electron microscope

(+) amplification; (-) non-amplification

Fig 1 ar diagram showing the measurement of individual pollen grains size in male sterile vs male fertile flowers using scanning electron microscope

<bold>Cloning and sequencing:</bold>

The PCR amplified fragments of atp6-2 gene in male sterile lines were separated on 1% agarose stained with EtBr gel, excised and purified the fragments using Nucleospin® Gel and PCR Clean-Up Kit (Macherey-Nagel, Germany). Five µL of the eluted product was ligated into pTZ57RT cloning vector system. The pTZ57RT vector containing the ligated DNA was successfully transformed into DH5α strain of E.coli. Transformed colonies were spread on Luria Bertani agar/Ampicillin/X-gal/IPTG plates and were identified through blue white screening after incubation at 370 overnight. Recombinant colonies were confirmed using colony PCR, further plasmid was isolated using alkaline lysis method. The isolated plasmids were confirmed for the presence of insert (atp6-2 gene) by digestion with the restriction enzyme, EcoRI and the restriction digested products were separated on 1% agarose/ EtBr gel to differentiate two distinct bands of vector and the 850bp insert respectively. Before sequencing, PCR product clean-up was performed using Nucleospin® Gel and PCR Clean-Up Kit (Macherey- Nagel, Germany). The sequencing was carried out in ABI-3710 Prison automated DNA analyzer (Europhins, India).

 <bold>RESULTS AND DISCUSSION</bold>

We used two male sterile cytoplasm (S-cytoplasm) trait linked markers, atp6-2875 and orf456 (Ji et al.,2013and Kim et al., 2005, 2007) and one restoration-of-fertility (Rf) loci linked marker CRF (Gulyas et al.,2006) to validate nine male sterile and their corresponding nine maintainer lines. CMS linked SCAR markerorf456 amplified in allthe male sterile genotypes (S-cytoplasm), at an expected base pairs of 456 as shown in the Fig. 2 and this 456bp amplicon size was absent in all corresponding maintainer lines (.-cytoplasm) (Fig.2c, Table 2).Instead of amplifying at expected amplicon size of 875bp, atp6-2 marker amplified at 850 bp in all the nine male sterile genotypes (S-cytoplasm) (Fig.2b, Table 2).In order to confirm the 25bp difference in the amplicon size, further cloning and sequencing was undertaken. Five clones each of the male sterile lines were selected, plasmid isolated, purified and further sequenced (ABI- 3710 Prisom automated DNA analyzer). Sequence obtained from ABI-3710 Prisom automated DNA analyzer was analysed from NCBI site (www.ncbi.nlm.nih.gov) and checked for nucleotide sequence identity of the observed sequences and found that there is almost 99% identity for Capsicum annuum atp6-2 subunit.The presence of the expected amplicon pattern in all nine male sterile genotypes (S-cytoplasm) proved that the mitochondrial gene associated atp6-2 subunit is responsible for the transcription of the orf456 novel gene which indeed responsible for the cause of CMS in the cultivar varieties of hot peppers. Meanwhile, the nine corresponding male fertile/ maintainer lines (S-cytoplasm) failed to amplify at the expected amplicon size. The CMS lines which are phenotypically male sterile are genotypically carrying a sterile cytoplasm, . with rfrf loci and all the maintainer or fertile B lines are genotypically carrying a normal cytoplasm, N with rfrf loci.The one CRF-SCAR marker specific to restoration-of-fertility (Rf) locus as expected failed to amplify the 550bp fragment in any of the nine cytoplasmic male sterile (A) lines or cytoplasmic male fertile/maintainer (B) lines (Fig 2,Table 2).The complete absence of the CRF-SCAR marker in all genotypes used for the current study proves that these samples didn’t carry a restoration-of-fertility, Rf loci, indicating that the cytoplasm looks genotypically normal, N or sterile, S. Even though there are markers for identification of restoration-of-fertility (Rf) in hot pepper (Kumar et al., 2009, Kim et al., 2005, Zhang et al., 2000),CRF-SCAR marker (Gulyas et al.,2006) is the most commonly and widely used molecular marker for the detection of presence or the absence of restoration-of-fertility in CMS lines of hot pepper.

Further, using the scanning electron microscope (SEM) the morphological variation in pollen grain size among the nine male sterile and their corresponding maintainer lines (Fig.1& Plate 2) was studied measuring the length and breadth of pollen grains (Plate 2). Maximum variation in pollen grain length was observed among A lines compared to B lines, and it ranged from 12.2 to 46.2µM and 36.4 to 45.7µM, respectively. Similarly, maximum variation in pollen grain breadth was observed among A lines and ranged from 5.24 to 21.9 µM, whereas it ranged from 19.4 to 27. 8μM a mong B lines (Fig. 1 & Plate 2),respectively.

<bold>Images of male sterile vs male fertile flowers</bold>

Male sterile (A) lines showing shrinked anther Maintainer (B) lines showing bulged anther

Plate 1 Images of male sterile vs male fertile flowers

<bold>Images of male sterile vs male fertile anthers</bold>

(Single pollen SEM images at 2.5k magnification)

Plate 2 Images of male sterile vs male fertile anthers

The SEM images of the reproductive parts of the male sterile flowers morphologically found to be very shorter in size compared to the male fertile plants. The anther lobes of the male sterile flowers appeared to be shrivelled with less or shrunken pollen grains, whereas the male fertile plants have bulged anther lobes with abundant pollen grains . Plate 3b.. So as to see the distribution of the pollen grains inside the anther lobe, the cross section of the anther lobe was studied. The SEM images clearly distinguished the male sterile plants had no visible pollens inside the tetrad pollen chambers, rather the male fertile plants produced numerous functional pollens . Plate 3c. attached to the tetrad anther chambers. The stereo microscopy images of the dehisced flowers clearlyshowed the a bsence of pollens a t differ entmagnification in male sterile plants where as presence of abundant pollen grains were visible in and out ofthe anther lobes of male fertile plants as shown on Plate 3a.

Gel picture showing the amplification results with the three molecular markers across eight pairs of sterile and fertile lines used (A) atp6-2 marker (B) orf 456 marker and (C) restorer of fertility gene specific crfmarker. All PCR products were separated on 1.5% 1X TAE- agarose gel, stained with ethidium bromide dye. M= 100 bp ladder, serial number 1- 18 indicates the sample order as given in the table no.2. S= male sterile line, F= male fertile line and R= restoral line. Arrow head indicates the band size obtained. Fig 2 Gel picture showing the amplification results with the three molecular markers across eight pairs of sterile and fertile lines used (A) atp6-2 marker (B) orf 456 marker and (C) restorer of fertility gene specific crfmarker. All PCR products were separated on 1.5% 1X TAE- agarose gel, stained with ethidium bromide dye. M= 100 bp ladder, serial number 1- 18 indicates the sample order as given in the table no.2. S= male sterile line, F= male fertile line and R= restoral line. Arrow head indicates the band size obtained.

<bold>Male sterile vs male fertile (a) flower, (b) reproductive part and (c) cross section of anther lobe</bold> Plate 3 Male sterile vs male fertile (a) flower, (b) reproductive part and (c) cross section of anther lobe

<bold>CONCLUSION</bold>

CMS in crops is caused due to a failure to produce functional pollen or anthers (Gómez 1999, Pruitt and Hanson, 1991). Previously, the two male sterile cytoplasm (S-cytoplasm) trait linked molecular markers viz., atp6-2 and orf456 ( Ji et al.,2013 and Kim et al. , 2005, 2007)were identified and characterised in CMS lines of hot pepper, were further used for the hybrid seed production in a commercial scale. The CMS pepper lines, were validated with the existing SCAR markers linked to the male sterility in pepper.The eight hot pepper lines namely IIHR 3285, IIHR 3226 , IIHR 3287, and IIHR 3228 (four CMS and 4 maintainer lines) developed at ICAR- IIHR, Bangalore and the other ten hot pepper lines (5 CMS and 5 maintainer lines) received from AVRDC, Taiwan, are having common sterile cytoplasm and restoration-of-fertility genes as were successfully validated using the three already known SCAR markers i.e., two male sterile cytoplasm (S-cytoplasm) trait linked to atp6-2 and orf456 (Ji et al.,2013 and Kim et al., 2005, 2007) and one restoration-of-fertility (Rf) loci linked marker CRF (Gulyaset al.,2006) and these molecular markers are highly reproducible at the genotypic level. Thus, these molecular markerscan be effectively used to recognize CMS from maintainer lines and fertility restorer lines and helps to fasten the breeding work to incorporate the CGMS system with varied fruit types and to incorporate disease resistant genes into A, B and R lines.

 Acknowledgments

The authors thank Indian Councilfor Agricultural Research (ICAR), New Delhi, India for providing funds under the Flagship programme on Studies on male sterility system to increase the efficiency of F1 hybrids in horticultural crops. The authors also express a word of thanks to the Director, ICAR-IIHR for constant encouragement and support.

 <bold>REFERENCES</bold> Budar F and Pelletier G (2001) Male Sterility in Plants; Occurrence, Determinism, Significance and Use. Life Science 324: 543-550. Budar F Pelletier G Male Sterility in Plants; Occurrence, Determinism, Significance and Use Life Science 2001 Doyle J J, Doyle JL (1990) Isolation ofplant DNA from fresh tissue. Focus 12:13–15. Doyle J J Doyle JL Isolation ofplant DNA from fresh tissue Focus 1990 Grelon M, Budar F, Bonhomme S, Pelletier G (1994) Ogura cytoplasmic male-sterility (CMS)- associated orf138 is translated into a mitochondrial membrane polypeptide in male sterile Brassica cybrids. Molecular Genetics and Genomics 243:540–547 Grelon M Budar F Bonhomme S Pelletier G Ogura cytoplasmic male-sterility (CMS)- associated orf138 is translated into a mitochondrial membrane polypeptide in male sterile Brassica cybrids Molecular Genetics and Genomics 1994 Gulyas G, Pakozdi K, Lee JS, Hirata Y (2006) Analysis of fertility restoration by using cytoplasmic male sterile red pepper (Capsicum annuum L.) lines. Breeding Science 56:331– 334. Gulyas G Pakozdi K Lee JS Hirata Y Analysis of fertility restoration by using cytoplasmic male sterile red pepper (Capsicum annuum L.) lines Breeding Science 2006 Hanson MR (1991) Plant mitochondrial mutations and malesterility. Annual Review of Genetics 25:461–486 Hanson MR Plant mitochondrial mutations and malesterility Annual Review of Genetics 1991 Hanson M and Bentolila S (2004) Interactions of mitochondrial andnuclear genes that affect male gametophyte development.Plant Cell 16:S154- S169 Hanson M Bentolila S Interactions of mitochondrial andnuclear genes that affect male gametophyte development Plant Cell 2004 Ji J J, Huang W, Yin C, Gong Z H (2013) Mitochondrial cytochrome c oxidase and F1Fo- ATPase dysfunction in peppers (Capsicum annuum L.) with cytoplasmic male sterility and its association with orf507 and atp6-2genes. International Journal Molecular Science 14:1050–1068. Ji J J Huang W Yin C Gong Z H Mitochondrial cytochrome c oxidase and F1Fo- ATPase dysfunction in peppers (Capsicum annuum L.) with cytoplasmic male sterility and its association with orf507 and atp6-2genes International Journal Molecular Science 2013 Kim DH, Kim BD (2005) Development of SCAR markers for early identification of cytoplasmic male sterility genotype in chili pepper (Capsicum annuum L.). Molecules & Cells 20:416–422. Kim DH Kim BD Development of SCAR markers for early identification of cytoplasmic male sterility genotype in chili pepper (Capsicum annuum L.) Molecules & Cells 2005 Kim DS, Kim DH, Yoo JY, Kim BD (2006) Cleaved amplified polymorphic sequence and amplified fragment length polymorphism markers linked to the fertility restorer gene in chili pepper (Capsicum annuum L.). Molecules & Cells 21:135–140. Kim DS Kim DH Yoo JY Kim BD Cleaved amplified polymorphic sequence and amplified fragment length polymorphism markers linked to the fertility restorer gene in chili pepper (Capsicum annuum L.) Molecules & Cells 2006 Kim DH, Kang JG, Kim BD (2007) Isolation and characterization of the cytoplasmic male sterility-associated orf456 gene of chili pepper (Capsicum annuum L.). Plant Molecular Biology 63:519–532. Kim DH Kang JG Kim BD Isolation and characterization of the cytoplasmic male sterility-associated orf456 gene of chili pepper (Capsicum annuum L.) Plant Molecular Biology 2007 Kumar R, Kumar S, Dwivedi N, Kumar S, Rai A, Singh M, et al., (2009) Validation of SCAR markers, diversity analysis of male sterile (S-) cytoplasm and isolation of an alloplasmic S- cytoplasm in Capsicum. Scientia Horticulturae. 120:167–172 Kumar R Kumar S Dwivedi N Kumar S Rai A Singh M Validation of SCAR markers, diversity analysis of male sterile (S-) cytoplasm and isolation of an alloplasmic S- cytoplasm in Capsicum Scientia Horticulturae 2009 Miller I and Bruns E (2016) The effect of disease on the evolution of females and the genetic basis of sex in populations with cytoplasmic male sterility. Proceedings. Biological Sciences. 283 : 20153035 Miller I Bruns E The effect of disease on the evolution of females and the genetic basis of sex in populations with cytoplasmic male sterility Proceedings Biological Sciences 2016 Peterson P A (1958) Cytoplasmically inherited male sterility in Capsicum .mericana. Naturalist 92:111–119. Peterson P A Cytoplasmically inherited male sterility in Capsicum americana Capsicum mericana Naturalist 1958 Pruitt K D and M R Hanson (1989) Cytochrome oxidase subunit II sequences in Petunia mitochondria: Two intron-containing genes and an intron-less pseudogene associated with cytoplasmic male sterility. Current Genetics. 16:281-291. Pruitt K D Hanson M R Cytochrome oxidase subunit II sequences in Petunia mitochondria: Two intron-containing genes and an intron-less pseudogene associated with cytoplasmic male sterility Current Genetics 1989 Pruitt K D and M R Hanson. (1991) Splicing of the Petunia cytochrome oxidase subunit II intron.Current Genetics. 19:191 197 Pruitt K D Hanson M R Splicing of the Petunia cytochrome oxidase subunit II intron Current Genetics 1991 Reddy MK., Sadashiva, A T, Deshpande, A A, (2002) Cytoplasmic male sterility in chilli (Capsicum annuum L.). Indian Journal of Genetics. 62:363–364 Reddy MK Sadashiva A T Deshpande A A Cytoplasmic male sterility in chilli (Capsicum annuum L.) Indian Journal of Genetics 2002 Schnable P S and Wise R P (1998) The molecular basis of cytoplasmic male sterility and fertility restoration. Trends in Plant Science .:175- 180. Schnable P S Wise R P The molecular basis of cytoplasmic male sterility and fertility restoration Trends in Plant Science 1998 Zhang B X, Huang S W, Yang G M, Guo J Z (2000) Two RAPD markers linked to a major fertility restorer gene in pepper. Euphytica 113:155- 161. Zhang B X Huang S W Yang G M Guo J Z Two RAPD markers linked to a major fertility restorer gene in pepper Euphytica 2000